Review



algorithms labsolution software v5 99 sp2 shimadzu corp  (Shimadzu Corporation)


Bioz Verified Symbol Shimadzu Corporation is a verified supplier
Bioz Manufacturer Symbol Shimadzu Corporation manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Shimadzu Corporation algorithms labsolution software v5 99 sp2 shimadzu corp
    Algorithms Labsolution Software V5 99 Sp2 Shimadzu Corp, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 99/100, based on 7903 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+labsolution+software+v5+99+sp2+shimadzu+corp/LabSolutions+Series/pm36736320-131-55-60
    Average 99 stars, based on 7903 article reviews
    algorithms labsolution software v5 99 sp2 shimadzu corp - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Software:

    Article Title: Direct activation of microglia by β-glucosylceramide causes phagocytosis of neurons that exacerbates Gaucher disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data bulk RNA-seq data This paper GEO: GSE202711 scRNA-seq data This paper GEO: GSE202929 Experimental models: Organisms/strains Mouse: WT: C57BL/6J CLEA Japan, Inc. C57BL/6JJcl Mouse: Clec4e / : B6.Mincle / Yamasaki et al.64 N/A Mouse: Nes-cre: B6.Cg-Tg(Nes-cre)1Kln/J The Jackson Laboratory RRID: IMSR_JAX:003771 Mouse: Cx3cr1-cre: B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J The Jackson Laboratory RRID: IMSR_JAX:025524 Mouse: CAG-FLPe: B6. .. Tg(CAG-flpe)36Ito RIKEN RRID: IMSR_RBRC01834 Mouse: Gbaflox/flox: B6.Gbaflox/flox This paper N/A Mouse: Clec4eflox/flox: B6.Clec4eflox/flox This paper N/A Oligonucleotides Primer for mouse Gba Forward: CCTTCAACTCCTCAAGATCTACTTGCC Eurofins Scientific N/A Primer for mouse Gba Reverse: CAGCTGAGGCTCAGGGCTAAGAG Eurofins Scientific N/A Primer for mouse Mincle Forward: GGTCAGGATGAGGACACAACAA Eurofins Scientific N/A Primer for mouse Mincle Reverse: GATTCGTACTCTCCCCTCCATT Eurofins Scientific N/A Software and algorithms LabSolution software v5.99 SP2 Shimadzu Corp. https://www.shimadzu.eu/ labsolutions-0 ImageJ Schneider et al.65 https://imagej.nih.gov/ij/ FlowJo v10.5.2 Tree Star Inc. https://www.flowjo.com/ BBrowser v2.10.48 BioTuring https://bioturing.com/bbrowser Mirion Paschke et al.66 https://pubs.acs.org/doi/full/ 10.1007/s13361-013-0667-0 LEGENDplex v8.0 BioLegend https://www.biolegend.com/en-us/ legendplex/software TopHat v2.0.13 Trapnell et al.67 https://cole-trapnell-lab.github.io/ projects/tophat/ Bowtie2 v2.2.3 Langmead and Salzberg68 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml SAMtools v0.1.19 Li et al.69 http://samtools.sourceforge.net/ Cufflink v2.2.1 Trapnell et al.70 http://cole-trapnell-lab.github.io/ cufflinks/ iDEP v0.91 Ge et al.71 http://bioinformatics.sdstate.edu/idep/ DESeq2 Love et al.72 https://bioconductor.org/packages/release/ bioc/html/DESeq2.html GraphPad Prism v9.1.0 GraphPad Software https://www.graphpad.com/ Other Poly-D-lysine-coated T-75 flask Corning Cat# 354537 Neuros syringe Hamilton Company Cat# 4015-63014 Immobilon-P PVDF membranes Merck Millipore Cat# IPVH20200 MAS-coated glass slide Matsunami Glass Industrial Cat# MAS-01 Chromium Next GEM Chip G Single Cell Kit 10X Genomics Cat# PN-1000127 Chromium Next GEM Single Cell 5’ Kit v2 10X Genomics Cat# PN-1000265 MS column Miltenyi Biotec Cat# 130-042-201 MACS Separator Miltenyi Biotec Cat# 130-042-501 Mouse anti-APC microbeads Miltenyi Biotec Cat# 130-090-855 (Continued on next page) e3 Immunity 56, 307–319.e1–e8, February 14, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse anti-biotin microbeads Miltenyi Biotec Cat# 130-090-485 TruSeq Stranded mRNA Library Prep Kit Illumina Cat# RS-122-2101

    Single Cell:

    Article Title: Direct activation of microglia by β-glucosylceramide causes phagocytosis of neurons that exacerbates Gaucher disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data bulk RNA-seq data This paper GEO: GSE202711 scRNA-seq data This paper GEO: GSE202929 Experimental models: Organisms/strains Mouse: WT: C57BL/6J CLEA Japan, Inc. C57BL/6JJcl Mouse: Clec4e / : B6.Mincle / Yamasaki et al.64 N/A Mouse: Nes-cre: B6.Cg-Tg(Nes-cre)1Kln/J The Jackson Laboratory RRID: IMSR_JAX:003771 Mouse: Cx3cr1-cre: B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J The Jackson Laboratory RRID: IMSR_JAX:025524 Mouse: CAG-FLPe: B6. .. Tg(CAG-flpe)36Ito RIKEN RRID: IMSR_RBRC01834 Mouse: Gbaflox/flox: B6.Gbaflox/flox This paper N/A Mouse: Clec4eflox/flox: B6.Clec4eflox/flox This paper N/A Oligonucleotides Primer for mouse Gba Forward: CCTTCAACTCCTCAAGATCTACTTGCC Eurofins Scientific N/A Primer for mouse Gba Reverse: CAGCTGAGGCTCAGGGCTAAGAG Eurofins Scientific N/A Primer for mouse Mincle Forward: GGTCAGGATGAGGACACAACAA Eurofins Scientific N/A Primer for mouse Mincle Reverse: GATTCGTACTCTCCCCTCCATT Eurofins Scientific N/A Software and algorithms LabSolution software v5.99 SP2 Shimadzu Corp. https://www.shimadzu.eu/ labsolutions-0 ImageJ Schneider et al.65 https://imagej.nih.gov/ij/ FlowJo v10.5.2 Tree Star Inc. https://www.flowjo.com/ BBrowser v2.10.48 BioTuring https://bioturing.com/bbrowser Mirion Paschke et al.66 https://pubs.acs.org/doi/full/ 10.1007/s13361-013-0667-0 LEGENDplex v8.0 BioLegend https://www.biolegend.com/en-us/ legendplex/software TopHat v2.0.13 Trapnell et al.67 https://cole-trapnell-lab.github.io/ projects/tophat/ Bowtie2 v2.2.3 Langmead and Salzberg68 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml SAMtools v0.1.19 Li et al.69 http://samtools.sourceforge.net/ Cufflink v2.2.1 Trapnell et al.70 http://cole-trapnell-lab.github.io/ cufflinks/ iDEP v0.91 Ge et al.71 http://bioinformatics.sdstate.edu/idep/ DESeq2 Love et al.72 https://bioconductor.org/packages/release/ bioc/html/DESeq2.html GraphPad Prism v9.1.0 GraphPad Software https://www.graphpad.com/ Other Poly-D-lysine-coated T-75 flask Corning Cat# 354537 Neuros syringe Hamilton Company Cat# 4015-63014 Immobilon-P PVDF membranes Merck Millipore Cat# IPVH20200 MAS-coated glass slide Matsunami Glass Industrial Cat# MAS-01 Chromium Next GEM Chip G Single Cell Kit 10X Genomics Cat# PN-1000127 Chromium Next GEM Single Cell 5’ Kit v2 10X Genomics Cat# PN-1000265 MS column Miltenyi Biotec Cat# 130-042-201 MACS Separator Miltenyi Biotec Cat# 130-042-501 Mouse anti-APC microbeads Miltenyi Biotec Cat# 130-090-855 (Continued on next page) e3 Immunity 56, 307–319.e1–e8, February 14, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse anti-biotin microbeads Miltenyi Biotec Cat# 130-090-485 TruSeq Stranded mRNA Library Prep Kit Illumina Cat# RS-122-2101

    Magnetic Cell Separation:

    Article Title: Direct activation of microglia by β-glucosylceramide causes phagocytosis of neurons that exacerbates Gaucher disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data bulk RNA-seq data This paper GEO: GSE202711 scRNA-seq data This paper GEO: GSE202929 Experimental models: Organisms/strains Mouse: WT: C57BL/6J CLEA Japan, Inc. C57BL/6JJcl Mouse: Clec4e / : B6.Mincle / Yamasaki et al.64 N/A Mouse: Nes-cre: B6.Cg-Tg(Nes-cre)1Kln/J The Jackson Laboratory RRID: IMSR_JAX:003771 Mouse: Cx3cr1-cre: B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J The Jackson Laboratory RRID: IMSR_JAX:025524 Mouse: CAG-FLPe: B6. .. Tg(CAG-flpe)36Ito RIKEN RRID: IMSR_RBRC01834 Mouse: Gbaflox/flox: B6.Gbaflox/flox This paper N/A Mouse: Clec4eflox/flox: B6.Clec4eflox/flox This paper N/A Oligonucleotides Primer for mouse Gba Forward: CCTTCAACTCCTCAAGATCTACTTGCC Eurofins Scientific N/A Primer for mouse Gba Reverse: CAGCTGAGGCTCAGGGCTAAGAG Eurofins Scientific N/A Primer for mouse Mincle Forward: GGTCAGGATGAGGACACAACAA Eurofins Scientific N/A Primer for mouse Mincle Reverse: GATTCGTACTCTCCCCTCCATT Eurofins Scientific N/A Software and algorithms LabSolution software v5.99 SP2 Shimadzu Corp. https://www.shimadzu.eu/ labsolutions-0 ImageJ Schneider et al.65 https://imagej.nih.gov/ij/ FlowJo v10.5.2 Tree Star Inc. https://www.flowjo.com/ BBrowser v2.10.48 BioTuring https://bioturing.com/bbrowser Mirion Paschke et al.66 https://pubs.acs.org/doi/full/ 10.1007/s13361-013-0667-0 LEGENDplex v8.0 BioLegend https://www.biolegend.com/en-us/ legendplex/software TopHat v2.0.13 Trapnell et al.67 https://cole-trapnell-lab.github.io/ projects/tophat/ Bowtie2 v2.2.3 Langmead and Salzberg68 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml SAMtools v0.1.19 Li et al.69 http://samtools.sourceforge.net/ Cufflink v2.2.1 Trapnell et al.70 http://cole-trapnell-lab.github.io/ cufflinks/ iDEP v0.91 Ge et al.71 http://bioinformatics.sdstate.edu/idep/ DESeq2 Love et al.72 https://bioconductor.org/packages/release/ bioc/html/DESeq2.html GraphPad Prism v9.1.0 GraphPad Software https://www.graphpad.com/ Other Poly-D-lysine-coated T-75 flask Corning Cat# 354537 Neuros syringe Hamilton Company Cat# 4015-63014 Immobilon-P PVDF membranes Merck Millipore Cat# IPVH20200 MAS-coated glass slide Matsunami Glass Industrial Cat# MAS-01 Chromium Next GEM Chip G Single Cell Kit 10X Genomics Cat# PN-1000127 Chromium Next GEM Single Cell 5’ Kit v2 10X Genomics Cat# PN-1000265 MS column Miltenyi Biotec Cat# 130-042-201 MACS Separator Miltenyi Biotec Cat# 130-042-501 Mouse anti-APC microbeads Miltenyi Biotec Cat# 130-090-855 (Continued on next page) e3 Immunity 56, 307–319.e1–e8, February 14, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse anti-biotin microbeads Miltenyi Biotec Cat# 130-090-485 TruSeq Stranded mRNA Library Prep Kit Illumina Cat# RS-122-2101



    Similar Products

    algorithms labsolution software v5 99 sp2 shimadzu corp  (Shimadzu Corporation)
    99
    Shimadzu Corporation algorithms labsolution software v5 99 sp2 shimadzu corp
    Algorithms Labsolution Software V5 99 Sp2 Shimadzu Corp, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+labsolution+software+v5+99+sp2+shimadzu+corp/LabSolutions+Series/pm36736320-131-55-60
    Average 99 stars, based on 1 article reviews
    algorithms labsolution software v5 99 sp2 shimadzu corp - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results